Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br B Generation of the SPOP KO

    2020-08-12


    B Generation of the SPOP KO Cell Lines B Real-Time Quantitative PCR
    B Immunoprecipitation (IP) and Western Blot B Immunofluorescence
    B Biotinylated Peptides Pull-Down Assay B GST Pull-Down Assay
    B Ubiquitination Assay B ELISA Assay
    B Genome DNA Extraction and SPOP Sequencing B TCGA Data Analysis
    B Structure Modeling B Statistical Analysis
    SUPPLEMENTAL INFORMATION
    Supplemental Information includes seven figures and can be found with this article online at https://doi.org/10.1016/j.devcel.2018.11.033.
    ACKNOWLEDGMENTS
    AUTHOR CONTRIBUTIONS
    DECLARATION OF INTERESTS
    The authors declare no competing interests.
    REFERENCES
    Hirsch, H.A., Iliopoulos, D., Tsichlis, P.N., and Struhl, K. (2009). Metformin selectively targets cancer stem cells, and acts together with chemotherapy to block tumor growth and prolong remission. Cancer Res. 69, 7507–7511.
    Emerging role of nanog in tumorigenesis and cancer stem cells. Int. J.
    Makrodouli, E., Oikonomou, E., Koc, M., Andera, L., Sasazuki, T., Shirasawa, S., and Pintzas, A. (2011). BRAF and RAS oncogenes regulate Rho GTPase pathways to mediate migration and invasion properties in human colon cancer cells: a comparative study. Mol. Cancer 10, 118.
    Miyazawa, K., Tanaka, T., Nakai, D., Morita, N., and Suzuki, K. (2014). Immunohistochemical sybr safe of four different stem cell markers in pros-tate cancer: high expression of NANOG in conjunction with hypoxia-inducible factor-1alpha expression is involved in prostate epithelial malignancy. Oncol. Lett. 8, 985–992.
    Zakikhani, M., Dowling, R.J., Sonenberg, N., and Pollak, M.N. (2008). The ef-fects of adiponectin and metformin on prostate and colon neoplasia involve activation of AMP-activated protein kinase. Cancer Prev. Res. (Phila) 1, 369–375.
    Zhang, K., Fowler, M., Glass, J., and Yin, H. (2014a). Activated 5’flanking region of NANOGP8 in a self-renewal environment is associated with increased sphere formation and tumor growth of prostate cancer cells. Prostate 74, 381–394.
    STAR+METHODS
    KEY RESOURCES TABLE
    REAGENT or RESOURCE SOURCE IDENTIFIER
    Antibodies
    Rabbit polyclonal antibody against In our lab N/A
    phospho-Ser68-NANOG
    Bacterial and Virus Strains
    DH5a TIANGEN Cat# CB101
    Chemicals, Peptides, and Recombinant Proteins
    MLN4924 Synthesized by GL Biochem (Shanghai) Ltd N/A
    NI-NTA agarose QIAGEN Cat# 30310
    cycloheximide Sigma Cat# C7698
    Compound C Selleck Cat# S7306
    LIF Millipore Cat# LIF1010
    AICAR Dr.Jia Li, National Center for Drug Screening, China N/A
    SB590885 Dr.Jia Li, National Center for Drug Screening, China N/A
    Metformin Dr.Jia Li, National Center for Drug Screening, China N/A
    Protein Kinase Inhibitor Library Dr.Jia Li, National Center for Drug Screening, China N/A
    Penicillin-streptomycin Gibco Cat# 15070063
    GST recombinant proteins In our lab N/A
    (Continued on next page)
    Continued
    REAGENT or RESOURCE SOURCE IDENTIFIER
    GST-SPOP In our lab N/A
    GST-SPOPDBTB In our lab N/A
    GST-SPOPDMATH In our lab N/A
    His-NANOG recombinant proteins In our lab N/A
    His-NANOGDPDSST
    In our lab
    Experimental Models: Cell Lines
    HEK293T Cell Bank, Chinese Academy of Sciences N/A
    DU145 Cell Bank, Chinese Academy of Sciences N/A
    22RV1 Cell Bank, Chinese Academy of Sciences N/A
    LNCaP Cell Bank, Chinese Academy of Sciences N/A
    PC3 Stem Cell Bank, Chinese Academy of Sciences. N/A
    E14 mESCs Dr.Xin Xie, National Center for Drug Screening, China N/A
    AMPKa1/a2 WT and KO MEFs Dr.Jia Li, National Center for Drug Screening, China N/A
    SPOP WT and KO cell lines
    In our lab
    Experimental Models: Organisms/Strains
    BALB/cA nude mice
    ShanghaiSippr-BK laboratory animal Co. Ltd.
    Oligonucleotides
    Spop F:ACCCTCTGCAGTAACCTGTC; N/A
    R:GTCTCCAAGACATCCGAAGC
    Yap1 F:AGATGGAGAAGGAGAGGCTG; N/A
    R:AGTGTTGGTAACTGGCTACG
    Adcy10 F:TCTACCACCTGATGGCTTAC; N/A
    R:TTACCCTGCCTGCTACAA
    Igfbp2 F:TCTGGAGCACCTCTACTCCCTG; N/A
    R:GTCTACTGCATCCGCTGGGT
    Acad8 F:CTCCAGGGTCCACCAGAT; N/A
    R:GAATAGAGCGGCCCACAT
    Trpm8 F:AAAGCCAACGACACCTCA; N/A
    R:AAACAGGCACCATTCTGG
    Birc5 F:AGCATTCGTCCGGTTGCGCT; N/A
    R: TCGATGGCACGGCGCACTTT
    Pfkfb1 F:TGAATGTGGAGGCCGTGAA; N/A
    R:AAGGCAGAGTAGGAGAAGAGCA
    Arx F:CCGACACCCAGCTTTCATC; N/A
    R:TGGAGGGCAGCCTTTAGC
    siCul1